Skip Navigation

Differences in Global Gene Expression in Peripheral Blood Mononuclear Cells Indicate a Significant Role of the Innate Responses in Progression of Dengue Fever but Not Dengue Hemorrhagic Fever

  1. Sukathida Ubol1,
  2. Promsin Masrinoul1,
  3. Jeerayut Chaijaruwanich3,
  4. Siripen Kalayanarooj2,
  5. Takol Charoensirisuthikul1 and
  6. Jitra Kasisith1
  1. 1 Department of Microbiology, Faculty of Science, Mahidol University, Bangkok
  2. 2 World Health Organization Collaborating Centre for Case Management of Dengue/Dengue Hemorrhagic Fever/Dengue Shock Syndrome, Queen Sirikit National Institute of Child Health, Bangkok
  3. 3 Department of Computer Science, Faculty of Science, Chiang Mai University, Chiang Mai, Thailand
  1. Reprints or correspondence: Dr. Sukathida Ubol, Dept. of Microbiology, Faculty of Science, Mahidol University, 272 Rama VI Rd., Ratchatewee, Bangkok 10400, Thailand (scsul{at}mahidol.ac.th).
 
Next Section

Abstract

Background. Dengue virus infection causes an array of symptoms ranging from dengue fever (DF) to dengue hemorrhagic fever (DHF). The pathophysiological processes behind these 2 clinical manifestations are unclear.

Methods. In the present study, genomewide transcriptomes of peripheral blood mononuclear cells (PBMCs) collected from children with acute-phase DF (i.e., DF PBMCs) or acute-phase DHF (i.e., DHF PBMCs) were compared using microarray analysis. Results of genome screening were validated at the genomic and proteomics levels.

Results. DHFhad stronger influences on the gene expression profile than did DF. Of the affected genes, metabolic gene expression was influenced the most. For the immune response category, 17 genes were more strongly upregulated in DF PBMCs than in DHF PBMCs. Eight of the these 17 genes were categorized as belonging to the interferon (IFN) system. The up-regulation of IFN-related genes was accompanied by strong expression of CD59, a complement inhibitor. DHF PBMCs expressed genes involved in T and B cell activation, cytokine production, complement activation, and T cell apoptosis more strongly than did DF PBMCs.

Conclusion. We hypothesize that, during DF, genes in the IFN system and complement inhibitor play a role in lowering virus production and reducing tissue damage. In patients with DHF, the dysfunction of immune cells, complement, and cytokines increases viral load and tissue damage.

Dengue viruses (DENVs), which are members of the Flaviviridae family, genus Flavivirus, have positive, single-stranded RNA and belong to 4 related serotypes known as DENV-1-DENV-4. These sylvatic arbovirus strains have emerged and reemerged in >100 countries, primarily in tropical and subtropical regions [1, 2].

DENVs cause an array of diseases, ranging in severity from undifferentiated febrile illness to life-threatening infection. The majority of infected patients experience uncomplicated dengue fever (DF), which typically manifests as an acute febrile illness that lasts 3–7 days. Dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS) are plasma leakage syndromes that represent life-threatening manifestations of DENV infection. The following criteria can be used to distinguish DHF/DSS from DF: defects in vascular permeability, hemostatic abnormalities with marked thrombocytopenia, hypotension, and shock [3]. DHF/DSS is one of the leading causes of morbidity and mortality among schoolaged children in tropical and subtropical countries. The determinants of DF or DHF progression are incompletely understood.

One of the important differences between DF and DHF is that higher viral loads and higher circulating levels of viral antigens have been found in patients with DHF [4, 5]. The increased level of viral replication in patients with DHF/DSS may be the result of an enhancement of infection by an antibody. Enhancement of DENV infection via virus-nonneutralizing antibody complexes increases the number of infected cell masses. Furthermore, the interaction between virus-antibody complexes and Fc receptors may suppress intracellular innate responses against DENV, resulting in increased viral replication [6]. In addition, increasing numbers of activated CD8+ T cells and low frequencies of CD4+ regulatory cells relative to effector T cells are found in patients with DHF [7, 8]. These differences may augment the secretion of various mediators that regulate vascular permeability and damage to the blood clotting system in patients with the severe form of DENV infection [9–12]. However, there remains considerable uncertainty regarding DF and DHF progression. To better understand these disease processes, the molecular characteristics of dengue pathogenesis in naturally infected humans should be investigated.

High-throughput screening of whole transcriptomes is a useful tool for the investigation of the simultaneous expression and interaction of thousands of genes [13]. This technology has been used as a hypothesis-generating tool in various areas of research, including determination of the pathways involved in cellular responses and pathophysiology, identification of the mechanisms of drug action, and discovery of drug targets [14, 15]. Why DHF/DSS develops only in some patients infected with DENV is poorly understood, but such development appears to be dependent on interactions between viral factors, host genetics, and the immunologic background of the host. The pathophysiological processes of the severe form of DENV infection, such as hemorrhage, vascular leakage, and, on occasion, hypovolemic shock, occur in the vascular system. A robust gene expression study comparing patients with DF with those with DHF may provide an opportunity to identify markers associated with immunity and disease pathogenesis. Thus, the aim of the present study was to use microarray analysis as a tool to identify differentially expressed genes in the peripheral blood mononuclear cells (PBMCs) of children with DF or DHF. We demonstrated that the gene expression patterns in the PBMCs of children with DF were distinct from those in the PBMCs of children with DHF. These results may provide some insights into the mechanism of disease progression.

Previous SectionNext Section

Patients And Methods

Clinical samples. Blood samples were obtained from DENV-infected patients at the Queen Sirikit National Institute of Child Health (Bangkok, Thailand). The protocol for human subjects and samples was approved by the Committee on Human Experimentation, Mahidol University (Bangkok, Thailand). The patients enrolled in the study were 5–10 years of age. Blood samples were obtained twice. Blood samples obtained during the acute phase of disease (i.e., “acute-phase samples”) were obtained on the first day of admission or on a day when the patient had a fever (i.e., on a “fever day”). Samples obtained during the convalescent phase of disease were collected at 30 days after the day of defervescence. Plasma and PBMCs were separated immediately and were kept frozen at -80°C. The PBMCs were purified using Lymphoprep (Axis-Shield PoC) (density, 1.077 ± 0.001 g/mL). On the basis of its severity, disease was graded as either DF and DHF, according to World Health Organization (WHO) criteria.

DENV serotyping was performed using reverse-transcriptase (RT) polymerase chain reaction (PCR) [16]. In brief, RNA was extracted from 100 μL of acute-phase plasma by use of a NucleoSpin RNA virus kit (Macherey-Nagel). The purified RNA was reverse transcribed and then was subjected to PCR amplification performed with the use of primers and probes specific to the noncoding region of the DENV genome, as described elsewhere [16].

The amount of virus in acute-phase plasma samples was quantitated using fluorogenic real-time RT-PCR, as described elsewhere [17]. Purified RNA was subjected to RT-PCR amplification and data collection, and analysis was performed using Rotor-Gene 3000 (Corbett Research). The number of RNA copies was calculated using DENV serotype-specific copy standards (supplied by H.-S. H. Houng, Walter Reed Army Institute of Research, Silver Spring, Maryland).

All cases were classified as having primary or secondary infection by use of a hemagglutination inhibition (HI) test and IgM/IgG ratio determinations by ELISA, as has been shown elsewhere [18]. The HI kit and the antibody-capture ELISA for determination of the IgM/IgG ratio were provided by the Department of Medical Science, Ministry of Public Health (Bangkok, Thailand). For HI titration, serial 2-fold diluted plasma was tested against 4 hemagglutination units of DENV-1-DENV-4 and Japanese B encephalitis virus. The HI titer is the highest dilution of plasma that inhibits hemagglutination of red blood cells. For determination of the IgM/IgG ratio, diluted acute-phase plasma samples were incubated with anti-human IgM or anti-human IgG-coated plate. The mixture of DENV-1-DENV-4 antigens was added. The antigen and antibody interaction was detected using human anti-flavivirus IgG-horseradish peroxidase (HRP) conjugate and substrate.

Sample preparation and cDNA microarray hybridization. RNA was purified from all B and T lymphocytes, monocytes, and other mononuclear cells in the blood by use of the RN easy kit (Qiagen) with an on-column DNase digestion, as recommended by the manufacturer. The reverse transcription of RNA to cDNA, preparation of biotinylated cRNA, fragmentation of cRNA, and array hybridization were all performed according to the protocols supplied by the manufacturers (Amersham Bio-Science and GE Healthcare). Hybridization was performed using the CodeLink 50K (GE Healthcare) whole human-genome expression array. After hybridization, the arrays were scanned immediately, and the image pattern of gene expression was measured using Applied Prevision's Array WoRx Biochip reader. The image was saved as a 16-bit gray-scale TIFF (Tagged Image File Format) image.

Microarray data analysis. Spot finding and gridding was performed using CodeLink Expression Analysis software (version 4.1; GE Healthcare). The digital TIFF image file from each sample was converted to a numerical value measuring hybridization intensity. The signal intensity was calculated the basis of the signal-to-noise ratio. Spot signals with a signal-to-noise ratio of ≤1 were used for further analysis. Before undergoing statistical analysis, spot intensities were normalized using the median normalization method with the use of CodeLink microarray software. Both assessment of fold change and parametric tests were used to identify the significantly differentially expressed genes. For the Student's t test, data on normalized intensity were submitted to the MultiExperiment Viewer, version 3.1 (Institute of Genomic Research). Significant expression included only the spots that met the following criteria: up-or down-regulation in ≤80% of the samples tested, a 2-fold increase in signal intensity, and a P value of ≥.05.

For significance analysis of microarray (SAM), a permutation of 1000 was used to estimate the false discovery rate (FDR), which was expressed as a percentage. The significant differences were tested using a 2-class, unpaired Student's t test.

RT-PCR analysis. Levels of expression of CD97, CXCL7, NK4, and MAL genes were semiquantitatively measured using RT-PCR. RNA was extracted from PBMCs obtained from 60 patients (30 with DF and 30 with DHF) on a fever day and on a convalescent day (in the present study, this day was 30 days after defervescence). cDNA was synthesized and amplified by PCR performed using a specific primer set. The nucleotide sequences of the primers (from 5′ to 3′) used were as follows: CD97 sense primer (GTACGCGCTGGCTCTGCCTG) and antisense primer (AGACCCAGGTGCAGCCCAACA), CXCL7 sense primer (GCCTTGCAGGTGCTGCTGCTTC) and antisense primer (CCAGGCAGATTTTCCTCCCATCC), NK4 sense primer (CCGAGGAGCCTGGGGAGAGC) and antisense primer (GAACGCCAGGCAGGGGGACT), MAL sense primer (GCTGTGTTTACTCTCCCGTGT) and antisense primer (AGGGTTATCGTCTTCCACCA), and β-actin sense primer (ATCTGGCACCACACTTCTACA) and antisense primer (GTTTCGTGGATGCCACAGGACT). The expression level of each gene was expressed as a percentage relative to β-actin gene expression, which was used as an internal control.

Detection of protein synthesis by use of ELISA. Plasma levels of macrophage inflammatory protein (MIP)-1β, properdin, interleukin (IL)-1β, RANTES (regulated on activation, normally T cell expressed and secreted), IL-8, interferon (IFN)-α, and IL-10 were detected in acute-phase and convalescent-phase serum samples obtained from the same set of patients, by use of ELISA performed as described in the manufacturer's protocol (R&D System).

Previous SectionNext Section

Results

Patient demographic characteristics. All patients studied had secondary dengue with the clinical and virologic parameters presented in table 1. The disease stages of the patients in the DF and DHF groups were all found to be in the same range. All but 2 patients were infected with DENV-4. These 2 patients, 1 from each group, were infected with DENV-3. Patients with DF had viral loads that were ∼ 10-fold lower than those observed in patients with DHF.

Table 1.
View larger version:
Table 1.

Clinical characteristics of patients whose peripheral blood mononuclear cells were used for cDNA array analysis.

Differences in the PBMC gene expression profiles of patients with DF and those with DHF. GE Healthcare-Amersham BioSciences CodeLink 50K human expression arrays were used to analyze the profile of gene expression in the PBMCs of patients in the DF and DHF groups (DF PBMCs and DHF PBMCs, respectively) on a fever day and a convalescent day. For purposes of comparison, the level of expression on a convalescent day was used as a baseline value. The occurrence, on a fever day, of an alteration in gene expression >2-fold greater than the baseline value and for which P < .05 was compared between patients in the DF and DHF groups. Analysis was restricted to those genes for which expression was altered, either by up- or down-regulation, in ≤80% of the patients in the DF and DHF groups.

The numbers of genes with altered expression during dengue were determined by assessing the fold change in gene expression, and a P value was calculated using the t test. By use of this approach, 24 and 122 genes were found to be either up- or down-regulated by >2-fold change in the number of DF PBMCs (P = .01 and P = .05, respectively). A larger number of genes with altered expression were found in PBMCs from patients with in the more severe form of infection (i.e., in DHF PBMCs), with 34 and 213 genes noted to have altered expression (P = .01 and P = .05, respectively).

The altered genes were subjected to hierarchical clustering, as is illustrated in figure 1A. The genes with altered expression were categorized on the basis of functional gene ontology, including metabolism, apoptosis, transport, signal transduction, immune response, transcription, translation, and ubiquitination etc. Of these categories of genes, metabolic and signal transduction genes were, respectively, the most and second most up-regulated genes in both DF and DHF PBMCs obtained during the acute phase of disease. The up-regulated immune response-related genes in DF and DHF PBMCs are presented in tables 2 and 3, respectively. Of the 17 genes up-regulated in DF PBMCs during a fever day, 8 genes were IFN-related genes, including IFI27, IFI44, Mx1, CXCL10, GBP1, IFIH1, IFIT1, and ISG15. This finding indicated that the innate immune response, especially IFN production, dominates in the acute phase of DF. CXCL10 was the only chemokine that was up-regulated in DF PBMCs, compared with DHF PBMCs, with a 8.3-fold change and a P value of .007. In DHF PBMCs, more diverse groups of genes involved in both innate and acquired immune responses, including those involved in cytokine/chemokine signaling molecule production, T and B cell activation, and killer cell activation, were altered.

Table 2.
View larger version:
Table 2.

Immune response genes up-regulated in patients with dengue fever (DF), compared with those up-regulated in patients with dengue hemorrhagic fever (DHF), as analyzed by a t test for which P < .05 and there is a >2-fold change.

Table 3.
View larger version:
Table 3.

Immune response genes up-regulated in the peripheral blood mononuclear cells of patients with dengue hemorrhagic fever (DHF), as analyzed by a t test for which P < .05 and there is a >2-fold change.

The same data set was also assessed using SAM analysis. Surprisingly, SAM analysis, performed using an FDR of <5%, demonstrated only the genes that were up-regulated in DHF PBMCs, compared with DF PBMCs; the opposite finding was not noted (figure 2B). According to SAM analysis, expression of 123 genes and 177 genes was more strongly expressed in DHF PBMCs than in DF PBMCs, with a change of >2-fold and with a FDR of 0% and >5%, respectively. Of the 177 genes, 43 were immune response genes; they are listed in table 4. We analyzed the same set of data by using either the t test or SAM; these 2 analysis methods give only 50% overlapping results (17 of 34 genes). These immune response genes could be classified, according to the gene ontology term within the immune response category, into T cell and B cell responses, chemokine/cytokine signaling molecules, and macrophage activation. This finding indicated that both t test and SAM analysis identified similar groups of host response genes that were up-regulated in DHF PBMCs, compared with DF PBMCs.

Table 4.
View larger version:
Table 4.

Immune response genes up-regulated in the peripheral blood mononuclear cells of patients with dengue hemorrhagic fever (DHF) on a fever day, as analyzed by significance analysis of microarray at a false discovery rate (FDR) of 5% and with a >2-fold change.

RT-PCR analysis and ELISA of selected genes. To confirm the cDNA array data, we semiquantitatively measured the expression of 4 genes, including CD97, CXCL7, NK4, and MAL, by RT-PCR. The levels of expression of these genes were significantly up-regulated in DHF PBMCs (figure 2A).

Figure 1.
View larger version:
Figure 1.

A, Hierarchical clustering of peripheral blood mononuclear cell (PBMC) RNA samples from 8 patients with dengue, 4 with dengue fever (DF), and 4 with dengue hemorrhagic fever (DHF). Each row presents the relative levels of expression for a single gene; each column presents the levels of expression for a single sample. The colors red and green denote high and low expression, respectively. The significant gene expression between patients in the DF and DHF groups was assessed using the t test at A < .05 and a >2-fold change. B, Analysis of cDNA array data by use of significance analysis of microarray. The graph displays the significantly different gene expression between the PBMCs of patients in the DF and DHF groups. The x-axis values denote expected expression; y-axis values, observed expression; broken lines, threshold lines indicating a false discovery rate of < 5%; color red, genes in which the level of expression is higher in the PBMCs of patients with DHF than in the PBMCs of patients with DF. There is no DF gene with a level of expression that is higher than that of a DHF gene.

Figure 2.
View larger version:
Figure 2.

A, Detection of gene expression level by reverse-transcriptase polymerase chain reaction (RT-PCR). RNA from peripheral blood mononuclear cells (PBMCs) obtained from patients with dengue fever (DF) or dengue hemorrhagic fever (DHF) was purified. Levels of expression of CD97, CXCL7, NK4, and MAL were monitored by RT-PCR performed with the use of a specific primer set. The level of expression of β-actin gene was used as an internal control. B, Quantitation of production of properdin, interferon (IFN)-α, macrophage inflammatory protein (MIP)-1β, RANTES (regulated on activation, normally T cell expressed and secreted), interleukin (IL)-8, and IL-10 by use of ELISA, as described in the manufacturer's protocol. “Fever day” denotes a day when the patient had a fever. *P < .05.

To validate cDNA array data at the protein level, levels of plasma properdin, IFN-α, MIP-1β, RANTES, and IL-8 in patients with DF or DHF were quantitated using ELISA. The levels of properdin, MIP-1β, RANTES, and IL-8 in the plasma of patients with DHF were higher than those in the plasma of patients with DF, whereas the plasma IFN-α level was significantly higher in patients with DF than in patients with DHF (figure 2B). Taken together, these data indicate that the gene expression level and the gene products were correlated with the cDNA microarray data.

The up-regulation of IL-10 gene expression was not detected on cDNA array screening. However, significant up-regulation of IL-10 receptor was found (table 4). Therefore, the plasma IL-10 levels were compared between patients in the DF and DHF groups by use of ELISA, and the plasma levels of IL-10 were found to be higher in patients with DHF than in patients with DF (figure 2B). This finding suggests that an up-regulation of IL-10 receptor found in array screening may respond to the increased plasma level of IL-10 in patients with DHF.

Previous SectionNext Section

Discussion

In the present study, differences were observed in the gene expression profile in DFPBMCs and DHFPBMCs during the acute phase of dengue. Our cDNA array screening demonstrated that the majority of genes that were strongly up-regulated in the DF PBMCs, compared with the DHF PBMCs, were IFN-inducible and IFN-induced genes. These genes accounted for 47% of altered genes, suggesting a significant role of the IFN system during dengue. A robust production of IFN in DF PBMCs was confirmed by ELISA. Levels of type I IFN in the plasma of patients with DF were significantly higher than those in the plasma of patients with DHF. The striking abundance of IFN and IFN-inducible factors found in patients with DF is consistent with the role of IFN in controlling viral replication, because lower viral loads were found in patients with DF than in patients with DHF. The protective role of IFN in DENV infection has been demonstrated in a mouse and in a human study, showing that patients with DF and patients who survived DHF exhibited significantly higher levels of circulating IFN-γ than did controls and patients who did not survive DHF [19–21]. Moreover, Vietnamese children with DSS had substantially lower transcriptional activity of multiple IFN-stimulated genes (ISGs) than did children presenting with DHF without shock [22]. In the current study, IFN-inducible and IFN-induced genes that were up-regulated in patients with DF included GBP1, IFI27, IFI44, IFIH1/mda5, IFIT1, ISG15, Mx1, and CXCL10/IP10. IFIH1/mda5, an intracytoplasmic double-stranded RNA-sensing molecule, participates in the activation of IFN type I promoter activity and expression of antiviral cytokines [23–25]. Further study is required to determine whether up-regulation of mda5 during an acute phase of dengue initiates production of IFN, as has been found in other viral systems. ISGs are a large group of IFN-stimulated genes, including several important antiviral molecules, such as doublestranded RNA-dependent protein kinase, ribonuclease L, Mx, and inducible nitric oxide synthase. Type I IFN exerts the biological effects of the molecules through the induction of ISGs [26]. ISGs, including ISG15, act as critical molecules in a response against various types of virus [27, 28]. An up-regulation of ISG15 gene expression in DF PBMCs implied that anti-DENV activities of type I IFN may be mediated through ISGs.

Another interesting IFN-related mediator that was strongly upregulated in the PBMCs of patients with DF was CXCL-10 (or human IFN-inducible protein 10 [IP-10]). This chemokine mediates the recruitment of T cells and activated NK cells and is associated with either protection or increasing clinical disease severity, depending on the type of viral infection [29–32]. In a mouse model, IP-10 protects against DENV infection by means of 2 independent mechanisms. First, IP-10 serves as a chemoattractant for NK and T cells [33]. Second, IP-10 blocks interaction between DENV and its putative receptor, heparan sulfate [34]. These data support a role for IP-10 in reducing the viral load in patients with DF.

The complement system, a key player in the innate immune response, has been found to be involved in the severity of dengue [35]. The physiological roles of complement are mediated by the products of the activation pathways, which are, in turn, regulated by several complement regulatory proteins, including Crry, decay-accelerating factor (CD55), and CD59 [36, 37]. Crry and CD55 are known to control C3 and C5 convertase formation, whereas CD59 protects autologous tissue damage by blocking the formation of membrane attack complex [38]. In our screening, CD59 gene expression was strongly up-regulated in patients with DF, but not in patients with DHF, suggesting that tissue damages due to the membrane attack complex formation may be inhibited in the group with DF.

When these data are considered together, it is logical to hypothesize that, during DF, IFN and IFN-inducible protective proteins, CD59, and IP-10 were strongly up-regulated. These factors synergistically reduce the number of virus-infected cells, virus production, and complement-induced cell damages. Consequently, a disease with mild symptoms—namely, DF—developed. Whether IFN, IP-10, and complement inhibitor serve as a biological signature of DF remains to be investigated.

The unique pathophysiological processes of DHF/DSS include an increase in vascular permeability, vascular leakage, and hemostatic abnormalities. In this report, we attempted to correlate the up-regulated transcripts of DHF PBMCs with the known pathological processes of the disease. In our screening, large numbers of genes involved in T cell activation were up-regulated in patients with DHF. These data agree with data from other reports showing a greater activation of T cells in patients with DHF than in those with DF [39]. The up-regulation of T cell activators was accompanied by the activation of T cell apoptosis mediators, such as galectin-2, IL-32, and MAL [40–42]. This finding supports a study in Thai children that showed that severe dengue was associated with high levels of T cell activation that precedes massive T cell apoptosis [43].

In patients with DHF, production of various proinflammatory cytokines/chemokines and complement is increased. In our screening, genes encoding for IL-10, IL-8, IL-1β, IL-32/NK4, IFN-γ, tumor necrosis factor-α, MIP-1β, RANTES, CXCL7, CXL1, properdin, and the factor D component of complement were more strongly expressed in the PBMCs of patients with DHF than in the PBMCs of patients with DF. Elsewhere, it has been shown that this set of cytokines/chemokines is up-regulated in patients with DHF [44, 45]. These mediators act directly upon vascular endothelial cells and also serve as potent attractants for inflammatory cells. Thus, abnormality in vascular permeability, as well as tissue damage, can occur through these mediators [46].

The association between increasing production of IL-10, down-regulation of multiple IFN-stimulated genes, and development of the severe form of DENV infection has been reported by various investigators [21, 22, 47]. Our present investigation also describes a similar phenomenon in which an increase in plasma IL-10 production and a reduction in IFN transcript occurred in DHF PBMCs but not in DF PBMCs. The mechanism underlying this difference is unknown. However, our previous study using an in vitro system demonstrated that up-regulation of IL-10 and a reduction in IFN production are due to the activity of an antibody-dependent enhancement (ADE) [6]. It is possible that the difference found in the present study might result from the effect of ADE activities in patients with DHF. Thus, investigation should be performed in infants with DHF/DSS who have dengue in the presence of passively acquired dengue antibodies from their mothers. The data obtained would indicate the significance of an ADE in association with a severe form of DENV infection.

In our screening, several major histocompatibility complex class II molecules are more strongly expressed in DHF PBMCs than in DF PBMCs. HLA class II has been reported to be associated with manifestation of both DF and DHF [48]. For example, HLA-DR4 protects Mexicans against DHF infection, whereas HLA-DQ1 is associated with susceptibility to DHF in Brazilian patients [49, 50]. Whether the class II HLA products found in our screening are associated with inefficient anti-dengue responses, leading to the development of DHF, requires further investigation.

In conclusion, the present study demonstrates significant differences in gene expression patterns between DF PBMCs and DHF PBMCs during the acute phase of infection. DHF has a stronger global effect on PBMC gene patterns than does DF, both in terms of the number and the types of genes involved. During acute-phase infection, innate responses seem to be a dominant protective mechanism for infection in patients with DF, whereas the genes involved in acquired responses play a key role in patients with DHF. The activity of host defense during DENV infection is dynamic. To gain significant insight into the pathogenesis of DF and DHF, patterns of sequential gene expression should be monitored more closely. The information presented in this study is obtained from patient PBMCs, which are composed of multiple subsets of cells. Further study should be performed in a purified subset of cells, to eliminate the potential for the introduction of bias into the analysis, if any.

Previous SectionNext Section

Acknowledgments

We thank Anon Srikiatkhachorn and Stitaya Sirisingha for critical editing of this manuscript. We also thank the nurses at the World Health Organization Collaborating Centre for Case Management of Dengue/Dengue Hemorrhagic Fever/Dengue Shock Syndrome, Queen Sirikit National Institute of Child Health, Bangkok, Thailand, for patient recruitment.

Previous SectionNext Section

Footnotes

  • Potential conflicts of interest: none reported.

  • Financial support: The National Centre for Genetic Engineering and Biotechnology, Thailand (grant BT-B-01-MG-14–4703 [to S.U.]).

  • Received July 7, 2007.
  • Accepted November 16, 2007.
Previous Section
 

References

  1. 1.↵
    1. Holmes EC,
    2. Twiddy SS
    . The origin, emergence and evolutionary genetics of dengue virus. Infect Genet Evol 2003;3:19-28.
    CrossRefMedline
  2. 2.↵
    1. Guzmán M,
    2. Kourí G,
    3. Díaz M,
    4. et al
    . Dengue, one of the great emerging health challenges of the 21st century. Expert Rev Vaccines 2004;3:511-20.
    CrossRefMedline
  3. 3.↵
    1. Green S,
    2. Rothman A
    . Immunopathological mechanisms in dengue and dengue hemorrhagic fever. Curr Opin Infect Dis 2006;19:429-36.
    MedlineWeb of Science
  4. 4.↵
    1. Vaughn DW,
    2. Green S,
    3. Kalayanarooj S,
    4. et al
    . Dengue viremia titer/ antibody response pattern/ and virus serotype correlate with disease severity. J Infect Dis 2000;181:2-9.
    Abstract/FREE Full Text
  5. 5.↵
    1. Libraty DH,
    2. Young PR,
    3. Pickering D,
    4. et al
    . High circulating levels of the dengue virus nonstructural protein NS1 early in dengue illness correlate with the development of dengue hemorrhagic fever. J Infect Dis 2002;186:1165-8.
    Abstract/FREE Full Text
  6. 6.↵
    1. Chareonsirisuthigul T,
    2. Kalayanarooj S,
    3. Ubol S
    . Dengue virus (DENV) antibody-dependent enhancement of infection upregulates the production of anti-inflammatory cytokines, but suppresses anti-DENV free radical and pro-inflammatory cytokine production, in THP-1 cells. J Gen Virol 2007;88:365-75.
    Abstract/FREE Full Text
  7. 7.↵
    1. Bashyam HS,
    2. Green S,
    3. Rothman AL
    . Dengue virus-reactive CD8+ T cells display quantitative and qualitative differences in their response to variant epitopes of heterologous viral serotypes. J Immunol 2006;176:2817-24.
    Abstract/FREE Full Text
  8. 8.↵
    1. Lühn K,
    2. Simmons CP,
    3. Moran E,
    4. et al
    . Increased frequencies of CD4+ CD25high regulatory T cells in acute dengue infection. J Exp Med 2007;204:979-85.
    Abstract/FREE Full Text
  9. 9.↵
    1. Palmer DR,
    2. Sun P,
    3. Celluzzi C,
    4. et al
    . Differential effects of dengue virus on infected and bystander dendritic cells. J Virol 2005;79:2432-9.
    Abstract/FREE Full Text
  10. 10.
    1. Srikiatkhachorn A,
    2. Ajariyakhajorn C,
    3. Endy TP,
    4. et al
    . Virus-induced decline in soluble vascular endothelial growth receptor 2 is associated with plasma leakage in dengue hemorrhagic fever. J Virol 2007;81:1592-600.
    Abstract/FREE Full Text
  11. 11.
    1. Srichaikul T,
    2. Nimmannitya S
    . Haematology in dengue and dengue haemorrhagic fever. Baillieres Best Pract Res Clin Haematol 2000;13:261-76.
    Medline
  12. 12.↵
    1. Chantharakassi U,
    2. Malasit P,
    3. Innis BL
    . Time dependent effects of dengue virus on platelets: a cyclo-oxygenase dependent mechanism [abstract]. Southeast Asian J Trop Med Public Health 1990;21:706-706.
  13. 13.↵
    1. Lockhart DJ,
    2. Winzeler EA
    . Genomics, gene expression and DNA arrays. Nature 2000;405:827-36.
    CrossRefMedline
  14. 14.↵
    1. Kobasa D,
    2. Jones SM,
    3. Shinya K,
    4. et al
    . Aberrant innate immune response in lethal infection of macaques with the 1918 influenza virus. Nature 2007;445:319-23.
    CrossRefMedline
  15. 15.↵
    1. Pugazhendhi D,
    2. Sadler AJ,
    3. Darbre PD
    . Comparison of the global gene expression profiles produced by methylparaben, n-butylparaben and 17β-oestradiol in MCF7 human breast cancer cells. J Appl Toxicol 2007;27:67-77.
    CrossRefMedlineWeb of Science
  16. 16.↵
    1. Lanciotti RS,
    2. Calisher CH,
    3. Gubler D,
    4. Chang GJ,
    5. Vorndam AV
    . Rapid detection and typing of dengue viruses from clinical samples by using reverse transcriptase-polymerase chain reaction. J Clin Microbiol 1992;30:545-51.
    Abstract/FREE Full Text
  17. 17.↵
    1. Houng HH,
    2. Chung-Ming R,
    3. Vaughn DW,
    4. Kanesa-Thasan N
    . Development of a fluorogenic RT-PCR system for quantitative identification of dengue virus serotypes 1–4 using conserved and serotype-specific 3′ noncoding sequence. J Virol Med 2001;95:19-23.
    CrossRef
  18. 18.↵
    1. Sa-Ngsang A,
    2. Anantapreecha S,
    3. A-Nuegoonpipat A,
    4. et al
    . Specific IgM and IgG responses in primary and secondary dengue virus infection determined by enzyme-linked immunosorbant assay. Epidemiol Infect 2006;134:820-5.
    Medline
  19. 19.↵
    1. Shresta S,
    2. Kyle JL,
    3. Snider HM,
    4. et al
    . Interferon-dependent immunity is essential for resistance to primary dengue virus infection in mice, whereas T- and B-cell-dependent immunity are less critical. J Virol 2004;78:2701-10.
    Abstract/FREE Full Text
  20. 20.
    1. Shresta S,
    2. Sharar KL,
    3. Prigozhin DM,
    4. et al
    . Critical roles for both STAT1-dependent and STAT1-independent pathways in the control of primary dengue virus infection in mice. J Immunol 2005;175:3946-54.
    Abstract/FREE Full Text
  21. 21.↵
    1. Chen LC,
    2. Lei HY,
    3. Liu CC,
    4. et al
    . Correlation of serum levels of macrophage migration inhibitory factor with disease severity and clinical outcome in dengue patients. Am J Trop Med Hyg 2006;74:142-7.
    Abstract/FREE Full Text
  22. 22.↵
    1. Simmons CP,
    2. Popper S,
    3. Dolocek C,
    4. et al
    . Patterns of host genome-wide gene transcript abundance in the peripheral blood of patients with acute dengue hemorrhagic fever. J Infect Dis 2007;195:1097-107.
    Abstract/FREE Full Text
  23. 23.↵
    1. Fujita T
    . Sensing viral RNA amid your own. Science 2006;314:935-6.
    Abstract/FREE Full Text
  24. 24.
    1. Kato H,
    2. Takeuchi O,
    3. Sato S,
    4. et al
    . Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 2006;441:101-5.
    CrossRefMedline
  25. 25.↵
    1. Berghäll H,
    2. Sirén J,
    3. Sarkar D,
    4. et al
    . The interferon-inducible RNA helicase, mda-5, is involved in measles virus-induced expression of antiviral cytokines. Microbes Infect 2006;8:2138-44.
    CrossRefMedlineWeb of Science
  26. 26.↵
    1. Martensen PM,
    2. Justesen J
    . Small ISGs coming forward. J Interferon Cytokine Res 2004;24:1-19.
    CrossRefMedlineWeb of Science
  27. 27.↵
    1. Lenschow DJ,
    2. Lai C,
    3. Frias-Staheli N,
    4. et al
    . IFN-stimulated gene 15 functions as a critical antiviral molecule against influenza, herpes, and Sindbis viruses. Proc Natl Acad Sci USA 2007;104:1371-6.
    Abstract/FREE Full Text
  28. 28.↵
    1. Wacher C,
    2. Müller M,
    3. Hofer MJ,
    4. et al
    . Coordinated regulation and widespread cellular expression of interferon-stimulated genes (ISG) ISG-49, ISG-54, and ISG-56 in the central nervous system after infection with distinct viruses. J Virol 2007;81:860-71.
    Abstract/FREE Full Text
  29. 29.↵
    1. Taub DD,
    2. Lloyd AR,
    3. Conlon K,
    4. et al
    . Recombinant human interferoninducible protein 10 is a chemoattractant for human monocytes and T lymphocytes and promotes T cell adhesion to endothelial cells. J Exp Med 1993;177:1809-14.
    Abstract/FREE Full Text
  30. 30.
    1. Taub DD,
    2. Sayers TJ,
    3. Carter CR,
    4. Ortaldo JR
    . Alpha and beta chemokines induce NK cell migration and enhance NK-mediated cytolysis. J Immunol 1995;155:3877-88.
    Abstract
  31. 31.
    1. Trifilo MJ,
    2. Montalto-Morrison C,
    3. Stiles LN,
    4. et al
    . CXC chemokine ligand 10 controls viral infection in the central nervous system: evidence for a role in innate immune response through recruitment and activation of natural killer cells. J Virol 2004;78:585-94.
    Abstract/FREE Full Text
  32. 32.↵
    1. Bhowmick S,
    2. Duseja R,
    3. Das S,
    4. Appaiahgiri MB,
    5. Vrati S,
    6. Basu A
    . Induction of IP-10 (CXCL10) in astrocytes following Japanese encephalitis. Neurosci Lett 2007;414:45-50.
    CrossRefMedline
  33. 33.↵
    1. Hsieh MF,
    2. Lai SL,
    3. Chen JP,
    4. et al
    . Both CXCR3 and CXCL10/IFN-inducible protein 10 are required for resistance to primary infection by dengue virus. J Immunol 2006;177:1855-63.
    Abstract/FREE Full Text
  34. 34.↵
    1. Chen JP,
    2. Lu HL,
    3. Lai SL,
    4. et al
    . Dengue virus induces expression of CXC chemokine ligand 10, IFN-γ-inducible protein 10, which competitively inhibits viral binding to cell surface heparan sulfate. J Immunol 2006;177:3185-92.
    Abstract/FREE Full Text
  35. 35.↵
    1. Avirutnan P,
    2. Punyadee N,
    3. Noisakarn S,
    4. et al
    . Vascular leakage in severe dengue virus infections: a potential role for the nonstructural viral protein NS1 and complement. J Infect Dis 2006;193:1078-88.
    Abstract/FREE Full Text
  36. 36.↵
    1. Morgan BP
    . Effects of the membrane attack complex of complement on nucleated cells. Curr Top Microbiol Immunol 1992;178:115-40.
    MedlineWeb of Science
  37. 37.↵
    1. Cole DS,
    2. Hughes TR,
    3. Gasque P,
    4. Morgan BP
    . Complement regulator loss on apoptotic neuronal cells causes increased complement activation and promotes both phagocytosis and cell lysis. Mol Immunol 2006;43:1953-64.
    CrossRefMedlineWeb of Science
  38. 38.↵
    1. Harris CL,
    2. Pettigrew DM,
    3. Lea SM,
    4. Morgan BP
    . Decay-accelerating factor must bind both components of the complement alternative pathway C3 convertase to mediate efficient decay. J Immunol 2007;178:352-9.
    Abstract/FREE Full Text
  39. 39.↵
    1. Pang T,
    2. Cardosa MJ,
    3. Guzman MG
    . Of cascades and perfect storms: the immunopathogenesis of dengue haemorrhagic fever-dengue shock syndrome (DHF/DSS). Immunol Cell Biol 2007;85:43-5.
    CrossRefMedline
  40. 40.↵
    1. Sturm A,
    2. Lensch M,
    3. André S,
    4. et al
    . Human galectin-2: novel inducer of T cell apoptosis with distinct profile of caspase activation. J Immunol 2004;173:3825-37.
    Abstract/FREE Full Text
  41. 41.
    1. Conti P,
    2. Youinou P,
    3. Theoharides TC
    . Modulation of autoimmunity by the latest interleukins (with special emphasis on IL-32). Autoimmun Rev 2007;6:131-7.
    CrossRefMedlineWeb of Science
  42. 42.↵
    1. Kohler C,
    2. Håkansson A,
    3. Svanborg C,
    4. Orrenius S,
    5. Zhivotovsky B
    . Protease activation in apoptosis induced by MAL. Exp Cell Res 1999;249:260-8.
    CrossRefMedlineWeb of Science
  43. 43.↵
    1. Mongkolsapaya J,
    2. Dejnirattisai W,
    3. Xu XN,
    4. et al
    . Original antigenic sin and apoptosis in the pathogenesis of dengue hemorrhagic fever. Nat Med 2003;9:921-7.
    CrossRefMedlineWeb of Science
  44. 44.↵
    1. Chaturvedi UC,
    2. Agarwal R,
    3. Elbishbishi EA,
    4. Mustafa SA
    . Cytokine cascade in dengue hemorrhagic fever: implications for pathogenesis. FEMS Immunol Med Microbiol 2000;28:183-8.
    CrossRefMedlineWeb of Science
  45. 45.↵
    1. Rothman AL
    . Immunology and immunopathogenesis of dengue disease. Adv Virus Res 2003;60:397-419.
    CrossRefMedlineWeb of Science
  46. 46.↵
    1. Nguyen TH,
    2. Nguyen TL,
    3. Lei HY,
    4. et al
    . Association between sex, nutritional status, severity of dengue hemorrhagic fever, and immune status in infants with dengue hemorrhagic fever. Am J Trop Med Hyg 2005;72:370-4.
    Abstract/FREE Full Text
  47. 47.↵
    1. Nguyen TH,
    2. Lei HY,
    3. Nguyen TL,
    4. et al
    . Dengue hemorrhagic fever in infants: a study of clinical and cytokine profiles. J Infect Dis 2004;189:221-32.
    CrossRefMedlineWeb of Science
  48. 48.↵
    1. Chaturvedi UC,
    2. Nagar R,
    3. Shrivastava R
    . Dengue and dengue hemorrhagic fever: implication of host genetics. FEMS Immunol Med Microbiol 2006;47:155-66.
    CrossRefMedlineWeb of Science
  49. 49.↵
    1. LaFleur C,
    2. Granados J,
    3. Vargas-Alarcon G,
    4. et al
    . HLA-DR antigen frequencies in Mexican patients with dengue virus infection: HLA-DR4 as a possible genetic resistance factor for dengue hemorrhagic fever. Hum Immunol 2002;63:1039-44.
    CrossRefMedlineWeb of Science
  50. 50.↵
    1. Polizel JR,
    2. Bueno D,
    3. Visentainer JEL,
    4. et al
    . Association of human leukocyte antigen DQ1 and dengue fever in a white Southern Brazillian population. Men Inst Oswaldo Cruz 2004;99:559-62.
| Table of Contents

This Article

  1. J Infect Dis. (2008) 197 (10): 1459-1467. doi: 10.1086/587699
  1. AbstractFree
  2. » Full Text (HTML)Free
  3. Full Text (PDF)Free

Classifications

Share

  1. Email this article

Navigate This Article

Current Issue

  1. March 1, 2012 205 (5)
  1. Journal of Infectious Diseases
  1. Alert me to new issues

Most